View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6304_low_25 (Length: 242)
Name: NF6304_low_25
Description: NF6304
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6304_low_25 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 15 - 231
Target Start/End: Complemental strand, 46999499 - 46999282
Alignment:
| Q |
15 |
tcacatataaccttcaccaccatgccgctctttctttttgttgcattgcatgttgttttttggctccataatttgtgttaccttcattgttttccaa-ca |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| || |
|
|
| T |
46999499 |
tcacatataaccttcaccaccatgccgctctttctttttgttgcattgcatgttgttttttggctccataatttgtgttactgtcattgttttccaaaca |
46999400 |
T |
 |
| Q |
114 |
acaccgcatgcatccaatctctgtcacagaggcacaattttccaactaatatcattcaaacgttccttcctacacccgtaaatataaccgccacgtgtcc |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
46999399 |
acaccgcatgcatccaatctctgtcacagaggcacaattttccaactaatatcattcaaacgttccttcctacgccagtaaatataaccgccacgtgtcc |
46999300 |
T |
 |
| Q |
214 |
ttctcacacaatgatgat |
231 |
Q |
| |
|
||||||||||||| |||| |
|
|
| T |
46999299 |
ttctcacacaatgctgat |
46999282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University