View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6304_low_27 (Length: 240)
Name: NF6304_low_27
Description: NF6304
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6304_low_27 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 111 - 240
Target Start/End: Original strand, 51210601 - 51210730
Alignment:
| Q |
111 |
tcagaggcgaaacctcagaattgtttatgatgctgttggaactttagctgaagctgttggggcagagctgaatcaggtatgctaatcaaccttcttcccc |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51210601 |
tcagaggcgaaacctcagaattgtttatgatgctgttggaactttagctgaagctgttggggcagagctgaatcaggtatgctaatcaaccttcttcccc |
51210700 |
T |
 |
| Q |
211 |
atcccaaaattttctcttttctcctcagtt |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
51210701 |
atcccaaaattttctcttttctcctcagtt |
51210730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 19 - 116
Target Start/End: Original strand, 51210471 - 51210568
Alignment:
| Q |
19 |
ctgtgttgatgtttcatttgaaatgaataatatttggaagagcaccatctctttattgtcactgtattttgtccttctcatcatatgcatggtcagag |
116 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
51210471 |
ctgtgttgatgtttcatgtgaaatgaataatatttggaagagcaccatctctttattgtcactgtattttgtccttctcatcatatgcatggccagag |
51210568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University