View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6305_high_8 (Length: 248)
Name: NF6305_high_8
Description: NF6305
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6305_high_8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 20 - 244
Target Start/End: Original strand, 37883370 - 37883595
Alignment:
| Q |
20 |
tattgcttaaactttctacattgatcatagagaaccataaacttcaacgataattaattttagaggtgtctttcaactcagccacataagtttctctcac |
119 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37883370 |
tattgcttaaactttctgaattgatcatagagaaccataaacttcaacgataattaattttagaggtgtctttcaactcagccacataagtttctctcac |
37883469 |
T |
|
| Q |
120 |
aactcagacatgtcttgctagctgatgctttagagggtgattgccatccatcaaatttgctttcctcatgttacctttaataaggagaacatataaaaaa |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
37883470 |
aactcagacatgtcttgctagctgatgctttagagggtgattgccatccatcaaatttgctttcctcatgttacctttaataaagagaacatataaaaaa |
37883569 |
T |
|
| Q |
220 |
cgatc-ctctcttccccttctctctt |
244 |
Q |
| |
|
|||| ||||||||||||||||||| |
|
|
| T |
37883570 |
tgatctatctcttccccttctctctt |
37883595 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University