View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6306_high_6 (Length: 304)
Name: NF6306_high_6
Description: NF6306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6306_high_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 287
Target Start/End: Complemental strand, 7152836 - 7152549
Alignment:
| Q |
1 |
ctaccacaaagttgactt-aatcttgttgcagagctttgtctttatctatgatgaatagatcatcaaggtcgagagcttttaatatctttgtgtatagtg |
99 |
Q |
| |
|
|||||||| ||||||| | |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7152836 |
ctaccacatagttgacctgaatcttgttgcagagccctgtctttatctatgatgaatagatcatcaaggtcgagagcttttaatatctttgtgtatagtg |
7152737 |
T |
 |
| Q |
100 |
tagcacaattccagagctttgacatgtagtgcagatcattgacttcatgtctagagctttgacttgatccagggctttaacttgatataactgaagtact |
199 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||| |||||||||||| |||| |||||||||| |
|
|
| T |
7152736 |
tagcacaagtccagagctttgacatgtagtgcagaacattgacttcatgtctagagctttgacttggtccatggctttaacttggtatagctgaagtact |
7152637 |
T |
 |
| Q |
200 |
tcacttgtacatagaatttcttgcacacttagacaagagtttggagagtcctaattattctcaatcatggttcgtatagtgctttgtt |
287 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
7152636 |
tcacctgtacatagaatttcttgcacacttagacaatcgtttggagagtcctaattattttcaatcatggttcgtatagtgctttgtt |
7152549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University