View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6306_high_8 (Length: 255)
Name: NF6306_high_8
Description: NF6306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6306_high_8 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 219; Significance: 1e-120; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 17 - 247
Target Start/End: Original strand, 26674254 - 26674484
Alignment:
| Q |
17 |
aaaaatttgtgagtaaattaaataaaaggatttttattataggataccaacggatactcaacctggattgttgagagcaaagaatgcatcaaagaagctg |
116 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26674254 |
aaaaattagtgagtaaattaaataaaaggatttttattataggataccaacggatactcaacctggattgttgagagcaaagaatgcatcaaagaagctg |
26674353 |
T |
|
| Q |
117 |
attgaattagggttagagttcactccagcagaacaaattatcaaggatgcagttgagtgtttgaagagtagaggtttggtttaacttgaagaaacctatt |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26674354 |
attgaattagggttagagttcactccagcagaagaaattatcaaggatgcagttgagtgtttgaagagtagaggtttggtttaacttgaagaaacctatg |
26674453 |
T |
|
| Q |
217 |
ggggctgaatacaatgtgacatgtgatgatg |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
26674454 |
ggggctgaatacaatgtgacatgtgatgatg |
26674484 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 124 - 166
Target Start/End: Original strand, 26730493 - 26730535
Alignment:
| Q |
124 |
tagggttagagttcactccagcagaacaaattatcaaggatgc |
166 |
Q |
| |
|
|||| |||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
26730493 |
taggtttagagtttactccagcagaacaaattatcaaggatgc |
26730535 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 161 - 198
Target Start/End: Original strand, 26695322 - 26695359
Alignment:
| Q |
161 |
ggatgcagttgagtgtttgaagagtagaggtttggttt |
198 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
26695322 |
ggatgcagttgagtgtatgaagagtagaggtttggttt |
26695359 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 206 - 247
Target Start/End: Original strand, 26730539 - 26730580
Alignment:
| Q |
206 |
agaaacctattggggctgaatacaatgtgacatgtgatgatg |
247 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| ||||| |
|
|
| T |
26730539 |
agaaacctatgggggctgaatacaatgtgacatgtggtgatg |
26730580 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 69 - 115
Target Start/End: Original strand, 30926040 - 30926086
Alignment:
| Q |
69 |
gatactcaacctggattgttgagagcaaagaatgcatcaaagaagct |
115 |
Q |
| |
|
||||| ||||||||| |||||||||||||| ||| |||||||||||| |
|
|
| T |
30926040 |
gatacacaacctggactgttgagagcaaaggatggatcaaagaagct |
30926086 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University