View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6306_low_7 (Length: 269)
Name: NF6306_low_7
Description: NF6306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6306_low_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 37 - 251
Target Start/End: Complemental strand, 39733909 - 39733695
Alignment:
| Q |
37 |
aaggggtgccttccagggcttggaaagagttcaaaaaagagaattgaagtcatggtggtgactacaccaaagtggctgctctctcatgttatctcttctt |
136 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39733909 |
aaggggtgccttccggggcttggaaagagttcaaaaaagagaattgaagtcatggtggtgactacaccaaagtggctgctctctcatgttatctcttctt |
39733810 |
T |
 |
| Q |
137 |
tctctcccacatttttctctcataaactacccaaaagtcatggtgagtttcctgcggtaaaggtagaggatacttttccacagggtagttagacccttct |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
39733809 |
tctctcccacatttttctctcataaactacccaaaagtcatggtgagtttcccgcggtaaaggtagaggatacttttccactgggtagttagacccttct |
39733710 |
T |
 |
| Q |
237 |
tttattcaacatgtc |
251 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
39733709 |
tttattcaacatgtc |
39733695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University