View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6307_high_2 (Length: 514)
Name: NF6307_high_2
Description: NF6307
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6307_high_2 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 457; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 457; E-Value: 0
Query Start/End: Original strand, 17 - 497
Target Start/End: Original strand, 8469378 - 8469858
Alignment:
| Q |
17 |
tacatcccaaagcccatacatcagaagcaaacccctgctcctccccgcgtgccacctccggtgccatgaaagccggtgtcccagaaatcaccaactcctc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8469378 |
tacatcccaaagcccatacatcagaagcaaacccctgctcctccccgcgtgccacctccggtgccatgaaagccggtgtcccagaaatcaccaactcctc |
8469477 |
T |
|
| Q |
117 |
ttccaccctcctagcacagccaaaatctgaaatcttggcaccttgttctgtcaccaacacgttctgtcccttcaaatcacaatgcactatcccattcaaa |
216 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8469478 |
ttccaccctcctagcacatccaaaatctgaaatcttggcaccttgttctgtcaccaacacgttctgtcccttcaaatcacaatgcactatcccattcaaa |
8469577 |
T |
|
| Q |
217 |
tgaagatagttaagccctagcagaatttgacgcgcatagaatcccaccatagcttcttccattccatttccattgcgaactgcatctgaaagagttccct |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8469578 |
tgaagatagttaagccctagcagaatttgacgcgcatagaatcccaccatagcttcttccattccatttccattgcgaactgcatctgaaagagttccct |
8469677 |
T |
|
| Q |
317 |
taggtgcatactccatgaacaagttgaacaattgaacaccattttcaaaggtgacttcacaaccttggtagctcacaatttgagaacactttaacttggt |
416 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
8469678 |
tgggtgcatactccatgaacaagttgaacaattgaacaccattttcaaaggtgacttcacaaccttggtagctcacaatttgaggacactttaacttggt |
8469777 |
T |
|
| Q |
417 |
cagaatttgttgttctttcttcaataactccgagcggtgaagctccgtagacttcaccgcaaatacttgaccaccagaatg |
497 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
8469778 |
cagaatttgttgttctttcttcaataactccgatcggtgaagctccgtagacttcaccgcaaacacttcaccaccagaatg |
8469858 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University