View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6307_low_7 (Length: 241)
Name: NF6307_low_7
Description: NF6307
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6307_low_7 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 200; Significance: 1e-109; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 14 - 225
Target Start/End: Original strand, 39111220 - 39111430
Alignment:
| Q |
14 |
cagagaggcaagccacttcatggcccttttgttgcagcattgcttaatgacctttttggcattcaagctcgaggtgggtgtgcttgtgctggaccttatg |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39111220 |
cagagaggcaagccacttcatggcccttttgttgcagcattgcttaatgacctttttggcattcaagctcgaggtgggtgtgcttgtgctggaccttatg |
39111319 |
T |
|
| Q |
114 |
gacatgaattactcaacatcaataaatctcaatcactttctattagatcagctgttcaagaggtgaaaaatcatcttatttccttgatattttttaggtt |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
39111320 |
gacatgaattactcaacatcaataaatctcaatcacttgctattagatcagctgttcaagaggtgaaaaatcatcttattt-cttgatattttttaggtt |
39111418 |
T |
|
| Q |
214 |
aaatgtttcttt |
225 |
Q |
| |
|
|||||||||||| |
|
|
| T |
39111419 |
aaatgtttcttt |
39111430 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 41 - 177
Target Start/End: Original strand, 39105215 - 39105351
Alignment:
| Q |
41 |
tttgttgcagcattgcttaatgacctttttggcattcaagctcgaggtgggtgtgcttgtgctggaccttatggacatgaattactcaacatcaataaat |
140 |
Q |
| |
|
||||||||| ||||| | || || || ||||| || ||| ||||||||||||||||||||||||||||||| |||||||| || |||||||||||| ||| |
|
|
| T |
39105215 |
tttgttgcaacattgttaaacgatctctttggaatacaatctcgaggtgggtgtgcttgtgctggaccttacggacatgatttgctcaacatcaatgaat |
39105314 |
T |
|
| Q |
141 |
ctcaatcactttctattagatcagctgttcaagaggt |
177 |
Q |
| |
|
||||||| ||| | |||||||||| |||||||||| |
|
|
| T |
39105315 |
ctcaatcgcttgccgttagatcagcaattcaagaggt |
39105351 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University