View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6307_low_8 (Length: 238)

Name: NF6307_low_8
Description: NF6307
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6307_low_8
NF6307_low_8
[»] chr3 (1 HSPs)
chr3 (1-222)||(7609769-7609990)


Alignment Details
Target: chr3 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 7609990 - 7609769
Alignment:
1 tacgagatagatacgaatattataacaatatgtccatacctattaattgcgggatccgcattcacttttggagagatttcatacagtttcacgatgtagt 100  Q
    ||||||||||||| |||||||||||||||||||||||||| || |||||||||| | |||||||||||||||||||||||||||||||||||||||||||    
7609990 tacgagatagatatgaatattataacaatatgtccatacccatcaattgcgggacctgcattcacttttggagagatttcatacagtttcacgatgtagt 7609891  T
101 aaatcttaaccataatttaaaatagagtttaaatttcaaacacaattttacgcggtaaaatgatttcgaccaccaatttatatgatcgaacggtccaaat 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
7609890 aaatcttaaccataatttaaaatagagtttaaatttcaaacacaattttacgcggtaaaataatttcgaccaccaatttatatgatcgaacggtccaaat 7609791  T
201 cagttacaatgtcctctataac 222  Q
    ||||||||||||||||||||||    
7609790 cagttacaatgtcctctataac 7609769  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University