View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6308_low_10 (Length: 280)
Name: NF6308_low_10
Description: NF6308
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6308_low_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 178; Significance: 5e-96; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 178; E-Value: 5e-96
Query Start/End: Original strand, 9 - 273
Target Start/End: Original strand, 12187726 - 12187990
Alignment:
| Q |
9 |
gttgctttgaccgcaatatgaatgatccctagacactgcttgtaacccaacatctttcctctttacctagattcatgctgtaaaa-gttacacacaccc- |
106 |
Q |
| |
|
|||| ||||||| |||||||| || ||||||||| | |||| ||||||||||||||| |||||||||||||| ||||| ||||| ||||||||||||| |
|
|
| T |
12187726 |
gttgttttgaccccaatatgagtg-tccctagactc--cttggaacccaacatctttcttctttacctagattaatgctttaaaaagttacacacacccc |
12187822 |
T |
|
| Q |
107 |
-tcattccatcaaactaatcttaaacgaccctgatacctttcacctttccgatgataattttagaattaaagtcttatgtacatcatgatatttacatgc |
205 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
12187823 |
ctcattccaccaaactaatcttaaacgaccctgatacctttcacctttcagatgataattttagaattaaagacttatgtacatcatgatatttacatgc |
12187922 |
T |
|
| Q |
206 |
cctgagtttcatgtaagcacttgtgcaccgaaagttaattaaaattcttgtcatcatcgttcttctca |
273 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
12187923 |
cctgagtttcaagtaagcacttgtgcaccgaaagttaattaaaattcttgtcatcatcgtccttctca |
12187990 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University