View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6309_high_5 (Length: 250)
Name: NF6309_high_5
Description: NF6309
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6309_high_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 89; Significance: 5e-43; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 11 - 99
Target Start/End: Complemental strand, 4240831 - 4240743
Alignment:
| Q |
11 |
atgaaaatggcatcacgtgaatctctttaagacaacccttctctttttagcctctcaattcttttatataagaaccctaccaccctttg |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4240831 |
atgaaaatggcatcacgtgaatctctttaagacaacccttctctttttagcctctcaattcttttatataagaaccctaccaccctttg |
4240743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 167 - 250
Target Start/End: Complemental strand, 4240674 - 4240591
Alignment:
| Q |
167 |
ccctatccctttgtactgtccactgttctttctctgtgtgttattataactcatcgatccatccatccatgactcctgtttctc |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4240674 |
ccctatccctttgtactgtccactgttctttctctgtgtgttattataactcatcgatccatccatccatgactcctgtttctc |
4240591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 58; Significance: 2e-24; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 167 - 236
Target Start/End: Complemental strand, 19923880 - 19923811
Alignment:
| Q |
167 |
ccctatccctttgtactgtccactgttctttctctgtgtgttattataactcatcgatccatccatccat |
236 |
Q |
| |
|
||||||| || |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
19923880 |
ccctatctctctgtactgtccactgttctttctctgtgtgttattataactcatcgatcgatccatccat |
19923811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 185 - 250
Target Start/End: Complemental strand, 19939740 - 19939677
Alignment:
| Q |
185 |
tccactgttctttctctgtgtgttattataactcatcgatccatccatccatgactcctgtttctc |
250 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
19939740 |
tccactgttctttct--gtgtgttattataactcatcgatccatccatccatgactcttgtttctc |
19939677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 37 - 85
Target Start/End: Complemental strand, 19939846 - 19939798
Alignment:
| Q |
37 |
ttaagacaacccttctctttttagcctctcaattcttttatataagaac |
85 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
19939846 |
ttaagacaacccttctcattttagcctctcaattcttttatataagaac |
19939798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University