View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6309_low_5 (Length: 250)

Name: NF6309_low_5
Description: NF6309
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6309_low_5
NF6309_low_5
[»] chr1 (2 HSPs)
chr1 (11-99)||(4240743-4240831)
chr1 (167-250)||(4240591-4240674)
[»] chr3 (3 HSPs)
chr3 (167-236)||(19923811-19923880)
chr3 (185-250)||(19939677-19939740)
chr3 (37-85)||(19939798-19939846)


Alignment Details
Target: chr1 (Bit Score: 89; Significance: 5e-43; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 11 - 99
Target Start/End: Complemental strand, 4240831 - 4240743
Alignment:
Q  11 atgaaaatggcatcacgtgaatctctttaagacaacccttctctttttagcctctcaattcttttatataagaaccctaccaccctttg 99  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  4240831 atgaaaatggcatcacgtgaatctctttaagacaacccttctctttttagcctctcaattcttttatataagaaccctaccaccctttg 4240743  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 167 - 250
Target Start/End: Complemental strand, 4240674 - 4240591
Alignment:
Q  167 ccctatccctttgtactgtccactgttctttctctgtgtgttattataactcatcgatccatccatccatgactcctgtttctc 250  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  4240674 ccctatccctttgtactgtccactgttctttctctgtgtgttattataactcatcgatccatccatccatgactcctgtttctc 4240591  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 58; Significance: 2e-24; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 167 - 236
Target Start/End: Complemental strand, 19923880 - 19923811
Alignment:
Q  167 ccctatccctttgtactgtccactgttctttctctgtgtgttattataactcatcgatccatccatccat 236  Q
    ||||||| || |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
T  19923880 ccctatctctctgtactgtccactgttctttctctgtgtgttattataactcatcgatcgatccatccat 19923811  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 185 - 250
Target Start/End: Complemental strand, 19939740 - 19939677
Alignment:
Q  185 tccactgttctttctctgtgtgttattataactcatcgatccatccatccatgactcctgtttctc 250  Q
    |||||||||||||||  |||||||||||||||||||||||||||||||||||||||| ||||||||    
T  19939740 tccactgttctttct--gtgtgttattataactcatcgatccatccatccatgactcttgtttctc 19939677  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 37 - 85
Target Start/End: Complemental strand, 19939846 - 19939798
Alignment:
Q  37 ttaagacaacccttctctttttagcctctcaattcttttatataagaac 85  Q
    ||||||||||||||||| |||||||||||||||||||||||||||||||    
T  19939846 ttaagacaacccttctcattttagcctctcaattcttttatataagaac 19939798  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University