View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6309_low_6 (Length: 244)
Name: NF6309_low_6
Description: NF6309
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6309_low_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 219; Significance: 1e-120; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 7911523 - 7911297
Alignment:
| Q |
1 |
tatcttaatcaactctgcttaacataatcttaactctaattacaattactagccgtcatatatctctaataaagacaaatcatgcatgtcttctaccaac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
7911523 |
tatcttaatcaactctgcttaacataatcttaactctaattacaattactagctgtcatatatctctaataaagacaaatcatgcaggtcttctaccaac |
7911424 |
T |
 |
| Q |
101 |
agtgctgctttacaatttccaaaacggatacttccctcatactagaatgcaattcaagacaaattatctcatagtgcaactattatagacaaattcaaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7911423 |
agtgctgctttacaatttccaaaacggatacttccctcatactagaatgcaattcaagacaaattatctcatagtgcaactattatagacaaattcaaat |
7911324 |
T |
 |
| Q |
201 |
ccgtatgaacaaagctatagaccgtct |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
7911323 |
ccgtatgaacaaagctatagaccgtct |
7911297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 177 - 223
Target Start/End: Complemental strand, 7879804 - 7879758
Alignment:
| Q |
177 |
caactattatagacaaattcaaatccgtatgaacaaagctatagacc |
223 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||||||| |||||||| |
|
|
| T |
7879804 |
caactattatagacaaatgcaaacccgtatgaacaaagttatagacc |
7879758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University