View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6310_low_14 (Length: 232)

Name: NF6310_low_14
Description: NF6310
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6310_low_14
NF6310_low_14
[»] chr2 (1 HSPs)
chr2 (19-161)||(40709025-40709167)


Alignment Details
Target: chr2 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 19 - 161
Target Start/End: Original strand, 40709025 - 40709167
Alignment:
19 cttaggctttcatggccattaatatcattgattttctatgaaaatgtggcaacggtaataaagaaattgattaagcatttagccacttgcaagatatata 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
40709025 cttaggctttcatggccattaatatcattgattttctatgaaaatgtggcaacggtaatgaagaaattgattaagcatttagccacttgcaagatatata 40709124  T
119 aaggacgcatggaaactatggcaggggaggaagtgatcaaaaa 161  Q
    |||||||||||||||||||||| ||||||||||||||||||||    
40709125 aaggacgcatggaaactatggccggggaggaagtgatcaaaaa 40709167  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University