View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6310_low_14 (Length: 232)
Name: NF6310_low_14
Description: NF6310
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6310_low_14 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 19 - 161
Target Start/End: Original strand, 40709025 - 40709167
Alignment:
| Q |
19 |
cttaggctttcatggccattaatatcattgattttctatgaaaatgtggcaacggtaataaagaaattgattaagcatttagccacttgcaagatatata |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40709025 |
cttaggctttcatggccattaatatcattgattttctatgaaaatgtggcaacggtaatgaagaaattgattaagcatttagccacttgcaagatatata |
40709124 |
T |
 |
| Q |
119 |
aaggacgcatggaaactatggcaggggaggaagtgatcaaaaa |
161 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
40709125 |
aaggacgcatggaaactatggccggggaggaagtgatcaaaaa |
40709167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University