View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6311_low_7 (Length: 249)
Name: NF6311_low_7
Description: NF6311
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6311_low_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 142; Significance: 1e-74; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 1 - 168
Target Start/End: Complemental strand, 39087853 - 39087687
Alignment:
| Q |
1 |
ctttgctgttgagatatcagtaaaattaagttggtgattaacaaaaaattaacaaccgatcgatggaatgtacctgccgtatgcacnnnnnnnatttgca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
39087853 |
ctttgctgttgagatatcagtaaaattaagttggtgattaacaaaaaattaacaaccgatcgatggaatgtacctgccgtatgcac-ttttttatttgca |
39087755 |
T |
 |
| Q |
101 |
agtatcttttcttttccaattttgttaaaacagtaaaaatccacatcacagcaaacaaatattattgg |
168 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39087754 |
agtatcttttcttttccaattttgttaaaacagtaaaaatccacatcacagcaaacaaatattattgg |
39087687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 39087661 - 39087612
Alignment:
| Q |
184 |
ttctatcatattagatttttactttgaaccaacacttcatcacaagctgat |
234 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||| ||||||||| |
|
|
| T |
39087661 |
ttctatcatattagatttttactttgaa-caacacttcatcgcaagctgat |
39087612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University