View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6311_low_8 (Length: 239)
Name: NF6311_low_8
Description: NF6311
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6311_low_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 58 - 224
Target Start/End: Original strand, 38864573 - 38864748
Alignment:
| Q |
58 |
gctggtaggcgtgtttgcttacccttcctgctgttctgttttcgtgttcaggttgtaa----gggtggggtttttaggtgctttgcttatttctttgggc |
153 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38864573 |
gctggtaggcgtgtttgcttacccttcctgctgttctgttttcgggttcaggttgtaagtaagggtggggtttttaggtgctttgcttatttctttgggc |
38864672 |
T |
 |
| Q |
154 |
ttaggttcctagtatat-----acgtgcttttgggttggtgttttgcatatattcggcaccttgtattggttccct |
224 |
Q |
| |
|
|||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38864673 |
ttaggttcctcgtatatacgggacgtgcttttgggttggtgttttgcatatattcggcaccttgtattggttccct |
38864748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 178 - 223
Target Start/End: Original strand, 9284375 - 9284420
Alignment:
| Q |
178 |
tttgggttggtgttttgcatatattcggcaccttgtattggttccc |
223 |
Q |
| |
|
||||| ||||||||| ||||||||||||||||||||| | |||||| |
|
|
| T |
9284375 |
tttggtttggtgtttcgcatatattcggcaccttgtaattgttccc |
9284420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University