View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6311_low_9 (Length: 224)

Name: NF6311_low_9
Description: NF6311
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6311_low_9
NF6311_low_9
[»] chr2 (1 HSPs)
chr2 (19-218)||(1675371-1675570)


Alignment Details
Target: chr2 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 19 - 218
Target Start/End: Complemental strand, 1675570 - 1675371
Alignment:
19 atagaggttccaggttgatacaacacattcttcattggttggaaaaggattgggaaatgaaagtgtcatccaaatttaaaatcatgaagctaatttttgt 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1675570 atagaggttccaggttgatacaacacattcttcattggttggaaaaggattgggaaatgaaagtgtcatccaaatttaaaatcatgaagctaatttttgt 1675471  T
119 gtggatgttttggcacctatgggttgtgaaggtggtagttcagtgataatatatatgagcaatgtccagctcatatttggcaatttacttttgatgatgt 218  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
1675470 gtggatgctttggcacctatgggttgtgaaggtggtagttcagtgataatatatatgagcaatgtccagctcatatttggcaatttacttttgctgatgt 1675371  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University