View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6312_low_4 (Length: 240)
Name: NF6312_low_4
Description: NF6312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6312_low_4 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 19 - 240
Target Start/End: Complemental strand, 39088180 - 39087981
Alignment:
| Q |
19 |
atgccttgcaaaatggaaagttatttgtggaggtgttttttgggtcacatgcaaaagggtcacgtgcttcactactcattaagagaaggagaaatgcaat |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
39088180 |
atgccttgcaaaatggaaagttatttgtggaggtgttttttgggtcacatgcaaaagggtcacgtgcttcactactcattaagagaaggagaaatacaat |
39088081 |
T |
|
| Q |
119 |
ggtgatgaggatcgaatccattttggaaagacaagaaaatgaatgtataggttttggttttggtgggttgacaagttatggaatggatggaacaatttat |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
39088080 |
ggtgatgaggatcgaatccattttggaaagacaagaaaatgaatgtat----------------------acaagttatggaatggatggaacaatttat |
39088003 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University