View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6313_high_2 (Length: 278)

Name: NF6313_high_2
Description: NF6313
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6313_high_2
NF6313_high_2
[»] chr4 (7 HSPs)
chr4 (14-278)||(37257070-37257346)
chr4 (141-278)||(37237614-37237751)
chr4 (211-278)||(37244887-37244954)
chr4 (108-192)||(37253022-37253106)
chr4 (56-120)||(37253136-37253200)
chr4 (141-278)||(37232699-37232824)
chr4 (56-104)||(37237812-37237860)
[»] chr6 (4 HSPs)
chr6 (211-278)||(14253966-14254033)
chr6 (211-278)||(14316694-14316761)
chr6 (207-278)||(14248156-14248227)
chr6 (128-189)||(14351662-14351723)
[»] scaffold1176 (2 HSPs)
scaffold1176 (143-278)||(303-438)
scaffold1176 (141-189)||(124-172)
[»] scaffold1652 (1 HSPs)
scaffold1652 (216-278)||(595-657)
[»] scaffold0902 (1 HSPs)
scaffold0902 (213-278)||(3212-3277)


Alignment Details
Target: chr4 (Bit Score: 220; Significance: 1e-121; HSPs: 7)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 14 - 278
Target Start/End: Complemental strand, 37257346 - 37257070
Alignment:
14 atatcacccgttgccactccacccaaatcctctcaggcaccatctccttcagctgtctcaccggtggcatctcctcccatacctgtgaagaacgctcctt 113  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||    
37257346 atatcacccgttgccactccacccaaatcctctcaggcaccatctccttccgctgtctcaccggtggcatctcctcccgtacctgtgaagaacgctcctt 37257247  T
114 ctccttcc------------tctgactctcccgctgtttctcctgctgttactccatcatccatctctactactccttctgaagcaccttcaccttcaga 201  Q
    ||||||||            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37257246 ctccttcccctcctgcttcctctgactctcccgctgtttctcctgctgttactccatcatccatctctactactccttctgaagcaccttcaccttcaga 37257147  T
202 caactccgccgccgcttttaacagattcaccgttgctggatctgccgctgttatggttttcgctgctgctttgatga 278  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||    
37257146 caactccgccgccgcttttaacagattcaccgttgctggatctgctgctgttatggttttcgccgctgctttgatga 37257070  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 141 - 278
Target Start/End: Complemental strand, 37237751 - 37237614
Alignment:
141 ctcctgctgttactccatcatccatctctactactccttctgaagcaccttcaccttcagacaactccgccgccgcttttaacagattcaccgttgctgg 240  Q
    |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| || ||||||  |||||| || |||||||||||| |||| |     
37237751 ctcctgctgttactccatcatccatctctactcctccttctgaagcaccttcaccttctgataactccatcgccgcattgaacagattcacctttgccgt 37237652  T
241 atctgccgctgttatggttttcgctgctgctttgatga 278  Q
    |||||| |||| | | ||||| ||||| ||||||||||    
37237651 atctgctgctgctgttgtttttgctgcagctttgatga 37237614  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 211 - 278
Target Start/End: Complemental strand, 37244954 - 37244887
Alignment:
211 cgccgcttttaacagattcaccgttgctggatctgccgctgttatggttttcgctgctgctttgatga 278  Q
    ||||||||| ||||||||||| ||||| |||||||| |||||| ||||||||||||||| ||||||||    
37244954 cgccgctttcaacagattcactgttgccggatctgctgctgttgtggttttcgctgctgttttgatga 37244887  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 108 - 192
Target Start/End: Complemental strand, 37253106 - 37253022
Alignment:
108 ctccttctccttcctctgactctcccgctgtttctcctgctgttactccatcatccatctctactactccttctgaagcaccttc 192  Q
    ||||| || |||| || |||||||||||||| ||||||||| |||||||||||||||| || ||| ||||||| |||| ||||||    
37253106 ctcctcctgcttcatccgactctcccgctgtctctcctgctcttactccatcatccatttccactcctccttccgaaggaccttc 37253022  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 56 - 120
Target Start/End: Complemental strand, 37253200 - 37253136
Alignment:
56 tctccttcagctgtctcaccggtggcatctcctcccatacctgtgaagaacgctccttctccttc 120  Q
    ||||| || |||| |||||||| ||||||| ||||||||||||||||||||||||| ||||||||    
37253200 tctccctccgctgactcaccggcggcatctgctcccatacctgtgaagaacgctccatctccttc 37253136  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 141 - 278
Target Start/End: Complemental strand, 37232824 - 37232699
Alignment:
141 ctcctgctgttactccatcatccatctctactactccttctgaagcaccttcaccttcagacaactccgccgccgcttttaacagattcaccgttgctgg 240  Q
    |||||||||||||||||||||| ||||| ||| ||||| |||||||||| |||         ||   || ||||||||| || |||||||||||||| ||    
37232824 ctcctgctgttactccatcatcgatctccactcctcctgctgaagcaccatca---------aa---cggcgccgctttgaatagattcaccgttgccgg 37232737  T
241 atctgccgctgttatggttttcgctgctgctttgatga 278  Q
    |||||| |||||| || |||||||||| ||||||||||    
37232736 atctgctgctgttgtgattttcgctgccgctttgatga 37232699  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 56 - 104
Target Start/End: Complemental strand, 37237860 - 37237812
Alignment:
56 tctccttcagctgtctcaccggtggcatctcctcccatacctgtgaaga 104  Q
    ||||| || |||| |||||||||||||||||||||| ||||||||||||    
37237860 tctccctccgctgactcaccggtggcatctcctcccgtacctgtgaaga 37237812  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 44; Significance: 4e-16; HSPs: 4)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 211 - 278
Target Start/End: Complemental strand, 14254033 - 14253966
Alignment:
211 cgccgcttttaacagattcaccgttgctggatctgccgctgttatggttttcgctgctgctttgatga 278  Q
    ||||||||| |||||||| || |||||||||||||| |||||  ||||||||||||||||||||||||    
14254033 cgccgctttgaacagatttacagttgctggatctgctgctgtcgtggttttcgctgctgctttgatga 14253966  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 211 - 278
Target Start/End: Complemental strand, 14316761 - 14316694
Alignment:
211 cgccgcttttaacagattcaccgttgctggatctgccgctgttatggttttcgctgctgctttgatga 278  Q
    ||||||||| |||||||| ||| |||| |||||||| |||||  ||||||||||||||||||||||||    
14316761 cgccgctttgaacagatttacccttgccggatctgctgctgtcgtggttttcgctgctgctttgatga 14316694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 207 - 278
Target Start/End: Complemental strand, 14248227 - 14248156
Alignment:
207 ccgccgccgcttttaacagattcaccgttgctggatctgccgctgttatggttttcgctgctgctttgatga 278  Q
    ||||||||||||| |||||||| || ||||| |||||| | |||||  ||||||| | ||||||||||||||    
14248227 ccgccgccgctttgaacagatttacagttgccggatctactgctgtcgtggtttttgttgctgctttgatga 14248156  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 128 - 189
Target Start/End: Complemental strand, 14351723 - 14351662
Alignment:
128 tctcccgctgtttctcctgctgttactccatcatccatctctactactccttctgaagcacc 189  Q
    |||||||||||  ||||||||||||||||||||||  |||||||| | || ||| |||||||    
14351723 tctcccgctgtcgctcctgctgttactccatcatcagtctctactccaccatctcaagcacc 14351662  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1176 (Bit Score: 36; Significance: 0.00000000002; HSPs: 2)
Name: scaffold1176
Description:

Target: scaffold1176; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 143 - 278
Target Start/End: Original strand, 303 - 438
Alignment:
143 cctgctgttactccatcatccatctctactactccttctgaagcaccttcaccttcagacaactccgccgccgcttttaacagattcaccgttgctggat 242  Q
    |||||| |||||||||| |||||||||||  |||| ||| ||||||| ||| | ||    |||  |||||||||||| |||||||| || ||||| ||||    
303 cctgctattactccatcgtccatctctacccctccatctaaagcaccatcaacgtccacaaacgacgccgccgctttgaacagatttacagttgccggat 402  T
243 ctgccgctgttatggttttcgctgctgctttgatga 278  Q
    || | |||||  ||||||||  ||||||||||||||    
403 ctactgctgtcgtggttttcattgctgctttgatga 438  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1176; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 141 - 189
Target Start/End: Original strand, 124 - 172
Alignment:
141 ctcctgctgttactccatcatccatctctactactccttctgaagcacc 189  Q
    |||||||||| ||||||||||| ||||||||| |||| ||| |||||||    
124 ctcctgctgtgactccatcatcgatctctactcctccatctcaagcacc 172  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1652 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold1652
Description:

Target: scaffold1652; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 216 - 278
Target Start/End: Original strand, 595 - 657
Alignment:
216 cttttaacagattcaccgttgctggatctgccgctgttatggttttcgctgctgctttgatga 278  Q
    |||| |||||||| || ||||| |||||||| |||||  |||||||| |||||||||||||||    
595 ctttgaacagatttacagttgccggatctgctgctgtcgtggttttcactgctgctttgatga 657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0902 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: scaffold0902
Description:

Target: scaffold0902; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 213 - 278
Target Start/End: Complemental strand, 3277 - 3212
Alignment:
213 ccgcttttaacagattcaccgttgctggatctgccgctgttatggttttcgctgctgctttgatga 278  Q
    ||||||| |||||||| || ||||| |||||||| |||||  |||||||| | |||||||||||||    
3277 ccgctttgaacagatttacagttgccggatctgctgctgtcgtggttttcacggctgctttgatga 3212  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University