View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6313_high_5 (Length: 251)
Name: NF6313_high_5
Description: NF6313
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6313_high_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 109 - 238
Target Start/End: Original strand, 32892596 - 32892725
Alignment:
| Q |
109 |
gaacctcaaagtttgggttatttccttgtcttatgggtctagtcacatgatctcgacccttgattcctggaaccttcttataaattttatactatttcta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32892596 |
gaacctcaaagtttgggttatttccttgtcttatgggtctagtcacatgatctcgacccttgattcctggaaccttcttataaattttatactatttcta |
32892695 |
T |
 |
| Q |
209 |
tttcacttcatagtcctttttctttggtct |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
32892696 |
tttcacttcatagtcctttttctttggtct |
32892725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 1 - 64
Target Start/End: Original strand, 32892488 - 32892551
Alignment:
| Q |
1 |
cacaaaactatagatgagagagtgtgtagaaagaaacacaaagtgtgatttggataattcagat |
64 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32892488 |
cacaaaactatagatgagagagtgtgtagaaagaaacacaaagtgtgatttggataattcagat |
32892551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University