View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6313_low_9 (Length: 242)
Name: NF6313_low_9
Description: NF6313
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6313_low_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 138; Significance: 3e-72; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 88 - 225
Target Start/End: Complemental strand, 32892196 - 32892059
Alignment:
| Q |
88 |
accattcaaatattcggttactcagacaacgtactttcaacaaagcattactgtctcatgcaccttcaaaacaaagaacaagaactactcatcatcatga |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32892196 |
accattcaaatattcggttactcagacaacgtactttcaacaaagcattactgtctcatgcaccttcaaaacaaagaacaagaactactcatcatcatga |
32892097 |
T |
 |
| Q |
188 |
tcaagctagaaccactacaaatgttggtgatccacttt |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32892096 |
tcaagctagaaccactacaaatgttggtgatccacttt |
32892059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 1 - 53
Target Start/End: Complemental strand, 32892280 - 32892228
Alignment:
| Q |
1 |
tgttgtgggtcatgttagtttttgctcttatagtaacattgtttttcgccatt |
53 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
32892280 |
tgttgtgggtcatgttagtttttgctcttatagtaacattgtttttctccatt |
32892228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University