View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6314_high_29 (Length: 431)
Name: NF6314_high_29
Description: NF6314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6314_high_29 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 232; Significance: 1e-128; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 169 - 412
Target Start/End: Complemental strand, 30389479 - 30389236
Alignment:
| Q |
169 |
ccatgaatgaagggtcgattaaagtcacacgatgatgttgatgatgataaagatcactttttgaggctaccacgaacaccaggacgaggcttggaggatt |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
30389479 |
ccatgaatgaagggtcgattaaagtcacacgatgatgttgatgatgataaagatcactttttgaggctaccacgaacaccagggcgaggcttggaggatt |
30389380 |
T |
|
| Q |
269 |
cagcaggagcagcagtagaagcatgcttgttaacaagcttttcttcttcaaaagggatctttggatgcttagcatcatgatgaatctgcatcgatttcac |
368 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30389379 |
cagcaggagcagcggtagaagcatgtttgttaacaagcttttcttcttcaaaagggatctttggatgcttagcatcatgatgaatctgcatcgatttcac |
30389280 |
T |
|
| Q |
369 |
atcaggtgctgtgattttgcagtgagggcactcccacttggcgt |
412 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30389279 |
atcaggtgctgtgattttgcagtgagggcactcccacttggcgt |
30389236 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 10 - 103
Target Start/End: Complemental strand, 30389638 - 30389545
Alignment:
| Q |
10 |
gacatcatcataacaacattcatatccaaaatgcatcattttgatattaaaaagacataaaagtacctaagcatacccatttgacaaattattc |
103 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30389638 |
gacagcatcataacaacattcatatccaaaatgcatcattttgatattaaaaagacataaaagtacctaagcatacccatttgacaaattattc |
30389545 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University