View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6314_high_55 (Length: 306)
Name: NF6314_high_55
Description: NF6314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6314_high_55 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 87; Significance: 1e-41; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 158 - 303
Target Start/End: Complemental strand, 46936515 - 46936380
Alignment:
| Q |
158 |
aatgcacaaaaagccaattatggacttcttaaatcctggtttactacatcttacgcactgcaccacaatacacacttatttatcatgtgaatataatttt |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| | | ||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
46936515 |
aatgcacaaaaagccaattatggacttcttaaataca----------aacttacgcactgcaccacaatacaaacttatttatcatgtgaatataatttt |
46936426 |
T |
 |
| Q |
258 |
tagaaggatgatgatggtgtcattattttgcaattttcttcgacat |
303 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
46936425 |
tagaaggatgatgatggtgtcattattttgcaatttttttggacat |
46936380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 18 - 86
Target Start/End: Complemental strand, 46936586 - 46936517
Alignment:
| Q |
18 |
ggatgttagtcttgtcg-caaagtaattcaagtaagttcccagggtgctgctttagtttttactgctggc |
86 |
Q |
| |
|
||||||||||||||||| | ||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
46936586 |
ggatgttagtcttgtcgacgaagtaattcaagtaagttcccggggtgctgctttagtttttactgctggc |
46936517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University