View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6314_high_56 (Length: 305)
Name: NF6314_high_56
Description: NF6314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6314_high_56 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 261; Significance: 1e-145; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 20 - 292
Target Start/End: Original strand, 31910161 - 31910433
Alignment:
| Q |
20 |
gatggttcagttaaacatattcagaagttcaacattggggctggactactcttcaataaattttggtgtaatgtaacccacatttattatctttttcttt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31910161 |
gatggttcagttaaacatattcagaagttcaacattggggatggactactcttcaataaattttggtgtaatgtaacccacatttattatctttttcttt |
31910260 |
T |
 |
| Q |
120 |
tgtatctcaccacagctgaatctttttcttttattgtaacttatctatgatgtttgctagcatagaattatgggacctgctaaaatggaccgtggtccgc |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
31910261 |
tgtatctcaccacagctgaatctttttcttttattgtaacttatctatgatgtttgctagcatagaattgtgggagctgctaaaatggaccgtggtccgc |
31910360 |
T |
 |
| Q |
220 |
aacagatcacatttttcattcaatctcaatctctattacactctttcacaaattttacattctagcaccatat |
292 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31910361 |
aacagatcacatttttcattcaatctcaatctctattacactctttcacaaattttacattctagcaccatat |
31910433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 162 - 244
Target Start/End: Original strand, 31902967 - 31903049
Alignment:
| Q |
162 |
atctatgatgtttgctagcatagaattatgggacctgctaaaatggaccgtggtccgcaacagatcacatttttcattcaatc |
244 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| | |||||||||||| |||||| ||||||||| |||| ||||||||||| |
|
|
| T |
31902967 |
atctatgatgtttgctagcatagaatcctgggaacgactaaaatggaccatggtccacaacagatcgcattattcattcaatc |
31903049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 197 - 246
Target Start/End: Original strand, 13643241 - 13643290
Alignment:
| Q |
197 |
tgctaaaatggaccgtggtccgcaacagatcacatttttcattcaatctc |
246 |
Q |
| |
|
|||||||||| ||| | |||| ||||| |||||||||||||||||||||| |
|
|
| T |
13643241 |
tgctaaaatgaaccattgtccacaacatatcacatttttcattcaatctc |
13643290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University