View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6314_high_64 (Length: 284)
Name: NF6314_high_64
Description: NF6314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6314_high_64 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 132; Significance: 1e-68; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 122 - 273
Target Start/End: Complemental strand, 3433258 - 3433107
Alignment:
| Q |
122 |
aatatatagtttcataagaactactcctttgaaggtaataagttgcaaaaacattgaacatagtgaggtgtaagtttgagcccacaattttccatttctt |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3433258 |
aatatatagtttcataagaactactcctttgaaggtaataagttgcaaaaacattgcccatagtgaggtgtaagtttgagcccacaattttccatttctt |
3433159 |
T |
 |
| Q |
222 |
atttagtgtgtgtgagttttgcggttaaatacttaataatcattgatatatt |
273 |
Q |
| |
|
|||||||||| ||||||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
3433158 |
atttagtgtgcgtgagttttgcggctaaacacttaataatcattgatatatt |
3433107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 35 - 84
Target Start/End: Complemental strand, 3433345 - 3433296
Alignment:
| Q |
35 |
ggttaaaatgcggtaagaatatttggtataacctcgtaactaagaagagg |
84 |
Q |
| |
|
||||| ||||||||||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
3433345 |
ggttacaatgcggtaagaacatttggtataacctcgtaattaagaagagg |
3433296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University