View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6314_high_66 (Length: 273)
Name: NF6314_high_66
Description: NF6314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6314_high_66 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 2 - 222
Target Start/End: Original strand, 24258701 - 24258921
Alignment:
| Q |
2 |
aattagaaaccctaaaagaagtgcatgtgagagttgttgaagagaaagttggtgagagtgaagttcactcaatgtgtgatgtgattatatgcttccttag |
101 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
24258701 |
aattaaaaaccctaaaagaagtgcatgtgagagttgttgaagagaaagttggtgagagtgaagttcactcaatatgtgaagtgattatatgcttccttag |
24258800 |
T |
 |
| Q |
102 |
aagggatctgacaccgaaggtttagccgtctttaaaggattgtgtgttttgcgaggatcatgtaggtttggttttgctcatatacacaagaaaattaagg |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24258801 |
aagggatctgacaccgaaggtttagccgtctttaaaggattgtgtgttttgcgaggatcacgtaggtttggttttgctcatatacacaagaaaattaagg |
24258900 |
T |
 |
| Q |
202 |
gcaaggctcttaaaaagagaa |
222 |
Q |
| |
|
|||| |||||||||||||||| |
|
|
| T |
24258901 |
gcaaagctcttaaaaagagaa |
24258921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University