View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6314_high_68 (Length: 262)
Name: NF6314_high_68
Description: NF6314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6314_high_68 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 19 - 247
Target Start/End: Original strand, 11179714 - 11179932
Alignment:
| Q |
19 |
aaaggttccttgtaatgtaaccaacgtctgaaaagaagggatcgaacaaacagcatagagcttttaattttgatatcgaaataaggcgcccaaatatttt |
118 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11179714 |
aaaggttccttttaatgtaaccaacgtctgaaaagaagggatcgaacaaacagcatagagcttttaattttgatatcgaaataaggcgcccaaatatttt |
11179813 |
T |
|
| Q |
119 |
gcaagttattagatatttcgacatggctctggcttgaacaagtagctaattgtggtgagcacagaattgaatggagttgaatggcactataaatgaatga |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
11179814 |
gcaagttattagatatttcgacatggctctggcttgaacaagtagctaattgtggtgagcacagaa----------ttgaatggcactataaatgaatga |
11179903 |
T |
|
| Q |
219 |
agaggatcatctcttaagcgtgatcttgc |
247 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
11179904 |
agaggatcatctcttaagcgtgatcttgc |
11179932 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University