View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6314_high_84 (Length: 244)
Name: NF6314_high_84
Description: NF6314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6314_high_84 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 19 - 226
Target Start/End: Original strand, 30575941 - 30576148
Alignment:
| Q |
19 |
gagcaatcgagtgaaaaatatacctgaaattcatataaatgttgagcaaaaacaactaccaattccaagagcagaaagttcaaccacattgtacattttt |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
30575941 |
gagcaatcgagtgaaaaatatacctgaaattcataaaaatgttgagcaaaaacaactaccaattccaagagcagaaagttcaaccgcattgtacattttt |
30576040 |
T |
|
| Q |
119 |
gatagagtcatatgaaaggaaaaactttcccaaccacgacatacagatctggtccgaatctgtgcttgccgagaatgaatgactttgttgtcgtagtggt |
218 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30576041 |
gatagagccatatgaaaggaaaaactttcccaactgcgacatacagatctggtccgaatctgtgcttgccgagaatgaatgactttgttgtcgtagtggt |
30576140 |
T |
|
| Q |
219 |
tggtttct |
226 |
Q |
| |
|
|||||||| |
|
|
| T |
30576141 |
tggtttct |
30576148 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University