View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6314_high_86 (Length: 240)

Name: NF6314_high_86
Description: NF6314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6314_high_86
NF6314_high_86
[»] chr4 (1 HSPs)
chr4 (37-223)||(2593955-2594141)


Alignment Details
Target: chr4 (Bit Score: 120; Significance: 2e-61; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 37 - 223
Target Start/End: Original strand, 2593955 - 2594141
Alignment:
37 tatatggatgaatctttgtcaagtttacaaatagatattttttaggcaagtcgtgtcattaaataataactttaggaatacctcaaaattggggaattta 136  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2593955 tatagggatgaatctttgtcaagtttacaaatagatattttttaggcaagtcgtgtcattaaataataactttaggaatacctcaaaattggggaattta 2594054  T
137 annnnnnnnnctatgcatgtagaattgaattttaagcnnnnnnnnnnnnaaaagctgtctattatttgaatcaacacatatcaatgt 223  Q
    |         |||||||||||||||||||||||||||            ||||||||||||||||||||||||||||||||||||||    
2594055 atttttttttctatgcatgtagaattgaattttaagctttttattttttaaaagctgtctattatttgaatcaacacatatcaatgt 2594141  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University