View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6314_high_87 (Length: 239)
Name: NF6314_high_87
Description: NF6314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6314_high_87 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 120; Significance: 2e-61; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 18 - 160
Target Start/End: Original strand, 25057207 - 25057350
Alignment:
| Q |
18 |
cctttctgctgtcaaactgaatttcgacatcagtgctatgttaaaccctttagaagtaaccaaagtagcgttctatctcagtggaatgacctctcgacca |
117 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
25057207 |
cctttctgctgtcaaactgaattttgacatcagtgctatgttaaaccctttagaagtaaccaaaacatcgttctatctcagtggaatgacctctcgacca |
25057306 |
T |
 |
| Q |
118 |
ctctgctggaacttgtcaataatcgtaaagcat-atgttgataa |
160 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
25057307 |
ctctgctggaacttgtcaataatcgtaaagcataatgttgataa |
25057350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 180 - 209
Target Start/End: Original strand, 25057343 - 25057372
Alignment:
| Q |
180 |
gttgataaggaaactggaaatgaaaagttc |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
25057343 |
gttgataaggaaactggaaatgaaaagttc |
25057372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University