View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6314_high_90 (Length: 238)
Name: NF6314_high_90
Description: NF6314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6314_high_90 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 188; Significance: 1e-102; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 3678261 - 3678486
Alignment:
| Q |
1 |
cctctcaatttaatttgttttactataatcttatgccttatagagtatattgtaaatttaacttcnnnnnnn----cagatggttgaaacatttacagga |
96 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
3678261 |
cctctcaatttaatttgttttactataatcttatgccttatagagtatattgtaaatttaacttctttttttttttcagatggttgaaacatttacagga |
3678360 |
T |
 |
| Q |
97 |
tattatgtatttgctcttggtgtctcaagatttgtatcattggcttattggattattcatgtgagattcgtaattttttcaatttggttcctagcttata |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3678361 |
tattatgtatttgctcttggtgtctcaagatttgtatcattggcttattggattattcatgtgagattcgtaattttttcaatttggttcctagcttata |
3678460 |
T |
 |
| Q |
197 |
ttttcatttggtttcataatataatt |
222 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
3678461 |
ttttcatttggtttcataatataatt |
3678486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 73 - 165
Target Start/End: Original strand, 3662999 - 3663091
Alignment:
| Q |
73 |
cagatggttgaaacatttacaggatattatgtatttgctcttggtgtctcaagatttgtatcattggcttattggattattcatgtgagattc |
165 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||| | |||||||||| ||||||||||||||| |||||| |
|
|
| T |
3662999 |
cagatcgttgaaacattcacaggatattatgtatttgctcttggtgtctcaagatttctctcattggctttttggattattcatgtaagattc |
3663091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 73 - 165
Target Start/End: Original strand, 3685874 - 3685966
Alignment:
| Q |
73 |
cagatggttgaaacatttacaggatattatgtatttgctcttggtgtctcaagatttgtatcattggcttattggattattcatgtgagattc |
165 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||||||||||||||| ||||||||| | ||| ||||||||||||||||||||||||||||| |
|
|
| T |
3685874 |
cagatggttgaaacattcacaggttattatgtatttgctcttggtgtttcaagatttttttcactggcttattggattattcatgtgagattc |
3685966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 73 - 161
Target Start/End: Original strand, 3669322 - 3669410
Alignment:
| Q |
73 |
cagatggttgaaacatttacaggatattatgtatttgctcttggtgtctcaagatttgtatcattggcttattggattattcatgtgag |
161 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||| |||||||| | || | || | |||||||||||||||||| |
|
|
| T |
3669322 |
cagatggttgaaacattcacaggatattatgtatttgctcttggtgtttcaagattcttcacacttgcattttggattattcatgtgag |
3669410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University