View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6314_low_105 (Length: 217)
Name: NF6314_low_105
Description: NF6314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6314_low_105 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 120; Significance: 1e-61; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 18 - 199
Target Start/End: Complemental strand, 39975608 - 39975426
Alignment:
| Q |
18 |
acatttacttcctgtcactggcaacaccaattgaat--ggtcgaattgaagtaggaaggaggggggtgttaacaaaattaaataacctcacctaccttct |
115 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
39975608 |
acatttacttcctgtcagtggcaacaccaattgaatatggtcgaattgaagtaggaaggaggggggtgctaacaaaattaaataacctcacctaccttct |
39975509 |
T |
 |
| Q |
116 |
attcttgcctacattacattctctggttttctagttttgctannnnnnnnnnnnaggaaaattattagactattacttttccat |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
39975508 |
attcttgcctacattacattctctggttttttagttttgcta-ttttttttttgaggaaaattattagactattacttttccat |
39975426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 45 - 135
Target Start/End: Complemental strand, 10995180 - 10995092
Alignment:
| Q |
45 |
caattgaatggtcgaattgaagtaggaaggaggggggtgttaacaaaattaaataacctcacc-taccttctattcttgcctacattacatt |
135 |
Q |
| |
|
|||||||||||| |||||||||||| | ||||| | ||||| |||||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
10995180 |
caattgaatggttgaattgaagtagta-ggaggag--tgttagcaaaattaaataacctcaccttaccttctattcttgcctctattacatt |
10995092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University