View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6314_low_32 (Length: 415)
Name: NF6314_low_32
Description: NF6314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6314_low_32 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 300; Significance: 1e-168; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 300; E-Value: 1e-168
Query Start/End: Original strand, 93 - 400
Target Start/End: Original strand, 37196620 - 37196927
Alignment:
| Q |
93 |
tatctatcaaatttgttgggtccaaaaatacacatttcctcactcaaatggcctctgtacgtttgtttttgttagctattttgatcattgtctcactttc |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
37196620 |
tatctatcaaatttgttgggtccaaaaatacacatttcctcactcaaatggcctctgtccgtttgtttttgttagctattttgatcattgtgtcactttc |
37196719 |
T |
|
| Q |
193 |
cagcattgacaatgtccaaggtggtgggactagaaaacttttgacacaaacatttcctgatttgggcaaaattccagggctagagtttcctcctttccca |
292 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37196720 |
cagcattgacaatgtccaaggtggtgggactagaaaacttttgacacaaacatttcctgatttgggcaaaattccagggctagagtttcctcctttccca |
37196819 |
T |
|
| Q |
293 |
ccagtgactgaatggccagagtacaggttgcctccacccattttcaatattcctgacttcttctctccaccatatgccaccacaactgctactaccaaac |
392 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37196820 |
ccagtgactgaatggccagagtacaggttgcctccacccattttcaatattcctgacttcttctctccaccatatgccaccacaactgctactaccaaac |
37196919 |
T |
|
| Q |
393 |
catgatga |
400 |
Q |
| |
|
|||||||| |
|
|
| T |
37196920 |
catgatga |
37196927 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 18 - 101
Target Start/End: Original strand, 37196515 - 37196598
Alignment:
| Q |
18 |
ttaagttgtactataaaaacacaagaaccaactcttatgttgtcacttgtcttcactcttctcccttactgcaattatctatca |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
37196515 |
ttaagttgtactataaaaacacaagaaccaactcttatgttgtcacttgtcttcactcttctcccttactacaattatctatca |
37196598 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University