View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6314_low_48 (Length: 339)

Name: NF6314_low_48
Description: NF6314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6314_low_48
NF6314_low_48
[»] chr7 (1 HSPs)
chr7 (23-323)||(4499910-4500210)
[»] scaffold0123 (1 HSPs)
scaffold0123 (167-285)||(13292-13410)
[»] chr6 (1 HSPs)
chr6 (167-285)||(17794744-17794862)
[»] chr1 (1 HSPs)
chr1 (99-224)||(17689316-17689442)
[»] chr3 (2 HSPs)
chr3 (199-285)||(14635880-14635966)
chr3 (233-285)||(13606444-13606496)
[»] chr8 (1 HSPs)
chr8 (209-286)||(24374015-24374091)


Alignment Details
Target: chr7 (Bit Score: 253; Significance: 1e-140; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 253; E-Value: 1e-140
Query Start/End: Original strand, 23 - 323
Target Start/End: Complemental strand, 4500210 - 4499910
Alignment:
23 ttctcaagtgtcccacattgctttagccattttacaatatgaaagcgagtgacactcatatatgcctaaggccaatatgagtgtgttcctcgctttcaaa 122  Q
    |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||| |||||||||    
4500210 ttctcaagtgtcccacattgctttagtcattttacaatatgaaagcgagtgacactcatatacgtctaaggccaatatgagtgtgttccttgctttcaaa 4500111  T
123 ttgtatcggaattatttttatcatcggctgttcaataggccttaggctcgttttgcatgacaccacaaatgtctatttgcggttcaaaccacccgttgac 222  Q
    |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
4500110 ttgtatcggaattatttttatcatcggctgttcaatcggccttaggctcgttttgcatgacaccacaaacgtctatttgcggttcaaaccacccgttgac 4500011  T
223 gacgacaactcaaacatccatgtcaactgatcgtatatgcacgctcatgcattctttccaatataaactctactgtacactcgtttaggatccttgcttg 322  Q
    ||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||| |  ||||||||||||||||||    
4500010 gacaacaactcaaacatccatgtcaaccgatcgtatatgcacgctcatgcattctttccaatataaactgtactgtacgccggtttaggatccttgcttg 4499911  T
323 t 323  Q
    |    
4499910 t 4499910  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0123 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 1)
Name: scaffold0123
Description:

Target: scaffold0123; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 167 - 285
Target Start/End: Complemental strand, 13410 - 13292
Alignment:
167 ggctcgttttgcatgacaccacaaatgtctatttgcggttcaaaccacccgttgacgacgacaactcaaacatccatgtcaactgatcgtatatgcacgc 266  Q
    |||| |||||| |||||||||  ||  ||||||||||||||||| | ||  || | ||||||| || |||||| | |||||||  || | ||||||||||    
13410 ggcttgttttgtatgacaccattaacatctatttgcggttcaaatctcctatttatgacgacatctgaaacatacgtgtcaaccaattgaatatgcacgc 13311  T
267 tcatgcattctttccaata 285  Q
    |||||||||||||||||||    
13310 tcatgcattctttccaata 13292  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 167 - 285
Target Start/End: Original strand, 17794744 - 17794862
Alignment:
167 ggctcgttttgcatgacaccacaaatgtctatttgcggttcaaaccacccgttgacgacgacaactcaaacatccatgtcaactgatcgtatatgcacgc 266  Q
    |||| |||||| |||||||||  ||  ||||||||||||||||| | ||  || | ||||||| || |||||| | |||||||  || | ||||||||||    
17794744 ggcttgttttgtatgacaccattaacatctatttgcggttcaaatctcctatttatgacgacatctgaaacatacgtgtcaaccaattgaatatgcacgc 17794843  T
267 tcatgcattctttccaata 285  Q
    ||||||||||||| |||||    
17794844 tcatgcattcttttcaata 17794862  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 99 - 224
Target Start/End: Complemental strand, 17689442 - 17689316
Alignment:
99 atgagtgtgttcctcgctttcaaattgtatcggaattattt-ttatcatcggctgttcaataggccttaggctcgttttgcatgacaccacaaatgtcta 197  Q
    |||||| ||||| |||||||||||| ||||  || ||  || |||||||| | ||| |||| |  |||||||| ||||||||||||||| | ||  | ||    
17689442 atgagtatgttcatcgctttcaaatcgtattagactttcttcttatcatcagttgtccaatcgatcttaggcttgttttgcatgacaccgccaacatata 17689343  T
198 tttgcggttcaaaccacccgttgacga 224  Q
    |||||||||||||||| ||||||||||    
17689342 tttgcggttcaaaccatccgttgacga 17689316  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 31; Significance: 0.00000003; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 199 - 285
Target Start/End: Original strand, 14635880 - 14635966
Alignment:
199 ttgcggttcaaaccacccgttgacgacgacaactcaaacatccatgtcaactgatcgtatatgcacgctcatgcattctttccaata 285  Q
    |||||||| ||||||||||||| | |||||| | || |||||||| || || ||| | || || |||||||| ||||||||||||||    
14635880 ttgcggttgaaaccacccgttggccacgacatcccacacatccatatctaccgattggatgtgaacgctcatccattctttccaata 14635966  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 233 - 285
Target Start/End: Original strand, 13606444 - 13606496
Alignment:
233 caaacatccatgtcaactgatcgtatatgcacgctcatgcattctttccaata 285  Q
    |||||||||||||| || ||| | ||||| ||||||||||| |||||||||||    
13606444 caaacatccatgtccaccgattggatatgaacgctcatgcactctttccaata 13606496  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 209 - 286
Target Start/End: Original strand, 24374015 - 24374091
Alignment:
209 aaccacccgttgacgacgacaactcaaacatccatgtcaactgatcgtatatgcacgctcatgcattctttccaatat 286  Q
    |||| ||||||||| |||||| | ||| ||| ||||||||| ||| | ||||| |||||||||||||||| |||||||    
24374015 aaccgcccgttgaccacgacatcccaa-cattcatgtcaaccgattggatatgaacgctcatgcattcttaccaatat 24374091  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University