View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6314_low_65 (Length: 284)
Name: NF6314_low_65
Description: NF6314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6314_low_65 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 34 - 259
Target Start/End: Complemental strand, 30296085 - 30295860
Alignment:
| Q |
34 |
gttgcttaaaacagtgatctgagaatgtattctttatccatatcttatactagctattggcaaattaaaaatatatctatcttatagctttcaccgtcac |
133 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
30296085 |
gttgcttaaaacagtgatctgagaatgtattctttatccatatcttatactagctattggcaaaataaaaatatatctatcttatagctttcaccgtcac |
30295986 |
T |
|
| Q |
134 |
gatataagtgtgaagagaatgattgatatgaacgatcttattgctttggccggctgtgtcatctttatgttttactaatttcttctatcaatacaaaatc |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30295985 |
gatataagtgtgaagagaatgattgatatgaacgatcttattgctttggccggctgtgtcatctttatgttttactaatttcttctatcaatacaaaatc |
30295886 |
T |
|
| Q |
234 |
attgtcacatttctctctcacacaca |
259 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
30295885 |
attgtcacatttctctctcacacaca |
30295860 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University