View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6314_low_69 (Length: 269)
Name: NF6314_low_69
Description: NF6314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6314_low_69 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 2 - 251
Target Start/End: Original strand, 7388483 - 7388732
Alignment:
| Q |
2 |
ggatgtcgaagaatatacatgattcaagtctttatataatggagaattatttatttcatagtattattgtgattctactaacataggaggctgcttttag |
101 |
Q |
| |
|
|||||| ||| ||| ||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7388483 |
ggatgtggaaaaatgtacatgattcaagtctttatataatagggaattatttatttcatagtattattgtgattctactaacataggaggctgcttttag |
7388582 |
T |
 |
| Q |
102 |
gtgctctttaatagttgcaagattttttccttnnnnnnnnnntaattgcaagacttttatgttatgtttctgtaaatggtggcattgttaaaaaagatta |
201 |
Q |
| |
|
||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7388583 |
gtgctctttaatagttgcaaggttttttccttcaaaaaaaaataattgcaagacttttatgttatgtttctgtaaatggtggcattgttaaaaaagatta |
7388682 |
T |
 |
| Q |
202 |
aatgtgattggttggattcattaaataagattcaactacaatggtagatc |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7388683 |
aatgtgattggttggattcattaaataagattcaactacaatggtagatc |
7388732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University