View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6314_low_71 (Length: 262)

Name: NF6314_low_71
Description: NF6314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6314_low_71
NF6314_low_71
[»] chr2 (1 HSPs)
chr2 (19-247)||(11179714-11179932)


Alignment Details
Target: chr2 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 19 - 247
Target Start/End: Original strand, 11179714 - 11179932
Alignment:
19 aaaggttccttgtaatgtaaccaacgtctgaaaagaagggatcgaacaaacagcatagagcttttaattttgatatcgaaataaggcgcccaaatatttt 118  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11179714 aaaggttccttttaatgtaaccaacgtctgaaaagaagggatcgaacaaacagcatagagcttttaattttgatatcgaaataaggcgcccaaatatttt 11179813  T
119 gcaagttattagatatttcgacatggctctggcttgaacaagtagctaattgtggtgagcacagaattgaatggagttgaatggcactataaatgaatga 218  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||          ||||||||||||||||||||||||    
11179814 gcaagttattagatatttcgacatggctctggcttgaacaagtagctaattgtggtgagcacagaa----------ttgaatggcactataaatgaatga 11179903  T
219 agaggatcatctcttaagcgtgatcttgc 247  Q
    |||||||||||||||||||||||||||||    
11179904 agaggatcatctcttaagcgtgatcttgc 11179932  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University