View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6314_low_88 (Length: 243)
Name: NF6314_low_88
Description: NF6314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6314_low_88 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 163; Significance: 4e-87; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 67 - 233
Target Start/End: Complemental strand, 50096154 - 50095988
Alignment:
| Q |
67 |
acctaccaagagataattttctattggattaggggctatgagagagcaacacaccaggctgagttaaccactaaactaaagggagtcaaaattgtgagaa |
166 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50096154 |
acctaccaaaagataattttctattggattaggggctatgagagagcaacacaccaggctgagttaaccactaaactaaagggagtcaaaattgtgagaa |
50096055 |
T |
 |
| Q |
167 |
ctattggattaggacaccaagttttaatcactaaactcaactttattaacacttcaagctgtctgtg |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50096054 |
ctattggattaggacaccaagttttaatcactaaactcaactttattaacacttcaagctgtctgtg |
50095988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 36
Target Start/End: Complemental strand, 50096191 - 50096156
Alignment:
| Q |
1 |
tttcaaaacgtcaaccctcaaagttagatttcataa |
36 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
50096191 |
tttcaaaacgtcaaccctcaaagttagatttcataa |
50096156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University