View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6314_low_89 (Length: 240)
Name: NF6314_low_89
Description: NF6314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6314_low_89 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 120; Significance: 2e-61; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 37 - 223
Target Start/End: Original strand, 2593955 - 2594141
Alignment:
| Q |
37 |
tatatggatgaatctttgtcaagtttacaaatagatattttttaggcaagtcgtgtcattaaataataactttaggaatacctcaaaattggggaattta |
136 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2593955 |
tatagggatgaatctttgtcaagtttacaaatagatattttttaggcaagtcgtgtcattaaataataactttaggaatacctcaaaattggggaattta |
2594054 |
T |
 |
| Q |
137 |
annnnnnnnnctatgcatgtagaattgaattttaagcnnnnnnnnnnnnaaaagctgtctattatttgaatcaacacatatcaatgt |
223 |
Q |
| |
|
| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2594055 |
atttttttttctatgcatgtagaattgaattttaagctttttattttttaaaagctgtctattatttgaatcaacacatatcaatgt |
2594141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University