View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6314_low_93 (Length: 238)
Name: NF6314_low_93
Description: NF6314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6314_low_93 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 5 - 222
Target Start/End: Complemental strand, 34976956 - 34976739
Alignment:
| Q |
5 |
acactttagattgaagatatgtctgggtgattgatatgtgtgttacaattattttcattgtcagtgttttatcgtgtccaacatccgtgtctctgtttca |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
34976956 |
acactttagattgaagatatgtctgggtgattgatatgtgtgttacaattattttcattgtcagtgttttatcgtttccaacatccgtgtctctgtttca |
34976857 |
T |
|
| Q |
105 |
taaaactttatccaaagactgagatctcttaggactttacttcatcaatgaactgcagttaatttgttattgtttttgtcaatgaagggcaagtgatcaa |
204 |
Q |
| |
|
|||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34976856 |
taaaacttcatccgaagactgagatctcttaggactttacttcatcaatgaactgcagttaatttgttattgtttttgtcaatgaagggcaagtgatcaa |
34976757 |
T |
|
| Q |
205 |
agggtgggatgaaggtat |
222 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
34976756 |
agggtgggatgaaggtat |
34976739 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University