View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6314_low_97 (Length: 236)
Name: NF6314_low_97
Description: NF6314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6314_low_97 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 28 - 220
Target Start/End: Original strand, 50096244 - 50096437
Alignment:
| Q |
28 |
ctttcggtaggtgtttttattgtattttgagcaatttagagggctcatagagaaactaccatacatgtataggaacaagggtgaattggttttttaaggg |
127 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| | |
|
|
| T |
50096244 |
ctttcggtagatgtttttattgtattttgagcaatttagagggctcatagagaaactaccatacatgtataggaacaagggtgaattgattttttaagag |
50096343 |
T |
 |
| Q |
128 |
gttgtctagttcaactagtttgagctaaaggtt-atgaattgaataggtccatcattcaagttgagattaggagaaaaaactaacataataatt |
220 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||| || |||||||||||||||||| |||| |
|
|
| T |
50096344 |
gttgtctagttcaactagtttaagctaaaggttgatgaattgaataggtccatcattcaagttgagactaagagaaaaaactaacataacaatt |
50096437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University