View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6314_low_98 (Length: 236)
Name: NF6314_low_98
Description: NF6314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6314_low_98 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 5052179 - 5052400
Alignment:
| Q |
1 |
aaatgttggattaccattagtcttggcccaaacatatacaaagtaacatttgatctattggttgtcctatcttataaactttttagcaccctggtataaa |
100 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
5052179 |
aaatgttggattgccattcgtcttggcccaaacatatacaaagtaacatttgatctattagttgtcctatcttagaaactttttagcaccctggtataaa |
5052278 |
T |
|
| Q |
101 |
aagcttaaaaaattcctataattgatcaataacctaacattttctacttttggcccccctgatattatatactttattgttttatttttgaaagacttgc |
200 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5052279 |
aagcttagaaaattcctataattgatcaataacctaacattttctacttttggcccccgtgatattatatactttattgttttatttttgaaagacttgc |
5052378 |
T |
|
| Q |
201 |
aaaaacatgctataaaaaatca |
222 |
Q |
| |
|
||||||||||||| |||||||| |
|
|
| T |
5052379 |
aaaaacatgctatgaaaaatca |
5052400 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University