View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6316_high_15 (Length: 346)
Name: NF6316_high_15
Description: NF6316
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6316_high_15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 91; Significance: 5e-44; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 91; E-Value: 5e-44
Query Start/End: Original strand, 10 - 144
Target Start/End: Complemental strand, 33442192 - 33442058
Alignment:
| Q |
10 |
gatgaagaccattgaaaagttgacgcagaaagggtggaggttcaatcatataaggcaaagttatctttcccttcatacaacacatagaaacatcacggga |
109 |
Q |
| |
|
||||||||||||||||||||||||| || ||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
33442192 |
gatgaagaccattgaaaagttgacggagcaagggaggaggttcaatcatataaggcaaagttatctttcccttcatacaacacattgaaacatcatggga |
33442093 |
T |
 |
| Q |
110 |
cagagtagtagaatcactgtgtgagcgctcgcgaa |
144 |
Q |
| |
|
|| ||||| ||| || || ||||||||||||||| |
|
|
| T |
33442092 |
caaagtagaagagtccctacgtgagcgctcgcgaa |
33442058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University