View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6316_low_20 (Length: 286)
Name: NF6316_low_20
Description: NF6316
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6316_low_20 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 269
Target Start/End: Complemental strand, 42903064 - 42902796
Alignment:
| Q |
1 |
tgtgtattgtcttgagaagtttgaaatttttccatggaaaaattgtaaaatctgtgtgaaagggtttacaattttctccttgtaaaaatagcaggttgag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42903064 |
tgtgtattgtcttgagaagtttgaaatttttccgtggaaaaattgtaaaatctgcgtgaaagggtttacaattttctccttgtaaaaatagcaggttgag |
42902965 |
T |
 |
| Q |
101 |
tgatnnnnnnnnttagtgaaatgccttttatttacnnnnnnnncttatcgagttaatattttctttaattactgtcccaataactagaataaaataaaag |
200 |
Q |
| |
|
|||| ||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
42902964 |
tgataaatttttttagtgaaatgccttttatttacttttttttcttatcgagttaatattttctttaactactgtcccaataactagaataaaataaaag |
42902865 |
T |
 |
| Q |
201 |
gtattacgggaagagagcaaaggctctaatcaagggaggaagagaagcattgtgtcgcgctatttattt |
269 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42902864 |
gtattacgggaagagagcaaaggctctaatcaagggaggaagagaagcattgtgtcgcgctatttattt |
42902796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University