View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6317_high_6 (Length: 255)
Name: NF6317_high_6
Description: NF6317
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6317_high_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 16 - 247
Target Start/End: Complemental strand, 16842707 - 16842477
Alignment:
| Q |
16 |
gatattatttataataaagaatacataatagaagagactcgtgcaaataagacttggttcggattccttnnnnnnnnnnnnntacttgattcggatcgtt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| || |||||||||||||| |||||||||| |||||||| |||||||| |
|
|
| T |
16842707 |
gatattatttataataaagaatacataatagaagagactcatgtaaataagacttggtccggattccttaaaaaaaaaaaag-acttgatttggatcgtt |
16842609 |
T |
 |
| Q |
116 |
gaatattgggcttcttacctacctatatggcccaattgggagagaaataatattgtgaaaagaagttctatcactgtgtcgtctcgcaaccgatcccaaa |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
16842608 |
gaatattgggcttcttacctacctatatggcccaattgggagagaaataatattgtgaaaagaagttctatcactgtgtcgtctcgcaaccgatctcaaa |
16842509 |
T |
 |
| Q |
216 |
tagttattagggtttaggtcattcagaataat |
247 |
Q |
| |
|
| |||||||||| ||||||||||||||||||| |
|
|
| T |
16842508 |
tggttattagggcttaggtcattcagaataat |
16842477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University