View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6317_low_1 (Length: 778)
Name: NF6317_low_1
Description: NF6317
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6317_low_1 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 158; Significance: 1e-83; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 158; E-Value: 1e-83
Query Start/End: Original strand, 64 - 249
Target Start/End: Original strand, 56311705 - 56311894
Alignment:
| Q |
64 |
gattttgaaagtataaaagaggagaagagcaaagggg-gtgt----gttgttgttagttagttagagagagtggatggcaatagcagcagcaacatcatc |
158 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56311705 |
gattttgaaagtataaaagaggaga-gagcaaaggggtgtgttgttgttgttgttagttagttagagagagtggatggcaatagcagcagcaacatcatc |
56311803 |
T |
 |
| Q |
159 |
acctaacatgagcagcatgagcttgagtcacgaagatggaacttctaacgataatattaacaaaggagctacagctacagttacagtagta |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56311804 |
acctaacatgagcagcatgagcttgagtcacgaagatggaacttctaacgataatattaacaaaggagctacagctacagttacagtagta |
56311894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 158; E-Value: 1e-83
Query Start/End: Original strand, 271 - 428
Target Start/End: Original strand, 56311922 - 56312079
Alignment:
| Q |
271 |
cacgagcatgacgtggttatgccagggtttcgtttccatccaactgaagaagaacttgtagagttctaccttcgccgtaaggtcgagggaaaacgtttca |
370 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56311922 |
cacgagcatgacgtggttatgccagggtttcgtttccatccaactgaagaagaacttgtagagttctaccttcgccgtaaggtcgagggaaaacgtttca |
56312021 |
T |
 |
| Q |
371 |
acgttgagcttattacttttctcgatctttatcgctatgacccttgggaacttcctgg |
428 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56312022 |
acgttgagcttattacttttctcgatctttatcgctatgacccttgggaacttcctgg |
56312079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 70; E-Value: 4e-31
Query Start/End: Original strand, 659 - 743
Target Start/End: Original strand, 56312280 - 56312367
Alignment:
| Q |
659 |
atttaatttaataattcacttcacatacatacgaaaatatga---tatgaagctgttatatatttagttatgtgattgaatttgatat |
743 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56312280 |
atttaatttaataattcacttcacatacatacgcaaatatgatgatatgaagctgttatatatttagttatgtgattgaatttgatat |
56312367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 475 - 541
Target Start/End: Original strand, 56312123 - 56312189
Alignment:
| Q |
475 |
gagaacttcccctttcctaaagcaattctggaaacccnnnnnnnngttgccatccctctttgattta |
541 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
56312123 |
gagaacttcccctttcctaaagcaattctggaaacccttttttttgttgccatccctctttgattta |
56312189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 292 - 329
Target Start/End: Original strand, 8449724 - 8449761
Alignment:
| Q |
292 |
ccagggtttcgtttccatccaactgaagaagaacttgt |
329 |
Q |
| |
|
||||||||||||||||| |||||||| ||||||||||| |
|
|
| T |
8449724 |
ccagggtttcgtttccacccaactgatgaagaacttgt |
8449761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University