View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6317_low_7 (Length: 221)
Name: NF6317_low_7
Description: NF6317
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6317_low_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 15 - 205
Target Start/End: Original strand, 11262147 - 11262337
Alignment:
| Q |
15 |
agcatagggtcaacaagtaaactttcaaaaattcgagatcttcttcatggaggttagatcaaatgtagaaaatattttccaatttaataatgcattggac |
114 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||| | |
|
|
| T |
11262147 |
agcattgggtcaacaagtaaactttcaaaaattcgagatcttcttcatggaggttagatcaaatgtagaaaatattttccaagttaataatgcaatggtc |
11262246 |
T |
 |
| Q |
115 |
attgacaagtacttgggtctcccatctttgatatgtaagagtaagaatgacaagtccaaattcaacaaggatcacgtgtagaggaagatta |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11262247 |
attgacaagtacttgggtctcccatctttgatatgtaagagtaagaatgacaagtccaaattcaacaaggatcacgtgtagaggaagatta |
11262337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University