View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6320_low_3 (Length: 241)
Name: NF6320_low_3
Description: NF6320
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6320_low_3 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 23 - 241
Target Start/End: Original strand, 31079060 - 31079278
Alignment:
| Q |
23 |
atgcatatgtaatgtctttttaaactacattatactcacgaggaagttatttactctagctttaattagttttcactgttaaacatgcactaaatatgtg |
122 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31079060 |
atgcatatgtaatgtctttttaaactaaattatactcacgaggacgttatttactctagctttaattagttttcactgttaaacatgcactaaatatgtg |
31079159 |
T |
 |
| Q |
123 |
gatctcaagttgaagctattgaaaattgaggagcttggtgcagaagaagtgtatgttggagcaaactcgtgtcgatgcatctttccttcccctcatgtat |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31079160 |
gatctcaagttgaagctattgaaaattgaggagcttggtgcagaagaagtgtatgttggagcaaactcgtgtcgatgcatctttccttcccctcatgtat |
31079259 |
T |
 |
| Q |
223 |
aatgtttgattatagcttt |
241 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
31079260 |
aatgtttgattatagcttt |
31079278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University