View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6321_high_13 (Length: 239)
Name: NF6321_high_13
Description: NF6321
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6321_high_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 213
Target Start/End: Original strand, 40410346 - 40410560
Alignment:
| Q |
1 |
aattaatcatgatacggagtctgcatattaatcttgttgttgatgttagaaactgctaattaatcacacttcacgtgatccgtgatcgtatgacttaaaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40410346 |
aattaatcatgatacggagtctgcatattaatcttgttgttgatgttagaaacggctaattaatcacacttcacgtgatccgtgatcgtatgacttaaaa |
40410445 |
T |
 |
| Q |
101 |
caaacaatatttgtggggtatatatagtccagctagtagctagggaggcaattttaggggtagcgagtagattaaaggagtgaagatataatca-tcttt |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
40410446 |
caaacaatatttgtggggtatatatagtccagctagtagctagggaggcaattttaggggtagcgagtagattaaaggagtgaagatataatcactcttt |
40410545 |
T |
 |
| Q |
200 |
cgg-ttaatcataat |
213 |
Q |
| |
|
||| ||||||||||| |
|
|
| T |
40410546 |
cggcttaatcataat |
40410560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University