View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6321_low_18 (Length: 205)

Name: NF6321_low_18
Description: NF6321
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6321_low_18
NF6321_low_18
[»] chr7 (1 HSPs)
chr7 (52-183)||(46922330-46922461)


Alignment Details
Target: chr7 (Bit Score: 132; Significance: 9e-69; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 132; E-Value: 9e-69
Query Start/End: Original strand, 52 - 183
Target Start/End: Original strand, 46922330 - 46922461
Alignment:
52 agaaaagaccaaaacagctcttgaagatggtttctagtttgcatggattgtgtctcacaatcttgcaccttaatgtcactacagctgatgaatttgtctt 151  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46922330 agaaaagaccaaaacagctcttgaagatggtttctagtttgcatggattgtgtctcacaatcttgcaccttaatgtcactacagctgatgaatttgtctt 46922429  T
152 ctattctctcagcgttaaggtaattgtctgtg 183  Q
    ||||||||||||||||||||||||||||||||    
46922430 ctattctctcagcgttaaggtaattgtctgtg 46922461  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University